Review



hindiii digested lambda phage dna  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs hindiii digested lambda phage dna
    Hindiii Digested Lambda Phage Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 10971 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lambda+dna/HindIII/pmc13179615-117-16-20
    Average 99 stars, based on 10971 article reviews
    hindiii digested lambda phage dna - by Bioz Stars, 2026-10
    99/100 stars

    Images

    Related Articles

    Agarose Gel Electrophoresis:

    Article Title: Detection of known gene fusions in cancer cell lines using whole-genome bisulfite sequencing data.
    Article Snippet: Spike-in controls AR TIC LE IN PR ES S consisting of pUC19 (0.1%) and lambda DNA (0.1%) from the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) were added to the sheared DNA.

    Article Title: Recognition and remodelling of nucleosomes and hexasomes by the human INO80 complex
    Article Snippet: Reactions were stopped by adding Lambda DNA (0.2 mg/ml; NEB).

    Article Title: Recognition and remodelling of nucleosomes and hexasomes by the human INO80 complex.
    Article Snippet: Reactions were stopped by adding Lambda DNA (0.2 mg/ml; NEB).

    Article Title: High-Yield Production of Modified DNA Enables Structural Analysis of PARP2 Recognition of Nucleosomal Single-Strand Breaks.
    Article Snippet: To amplify 601 and Lambda DNA (NEB, N3011S), the following template and primer sequences were used: 601 DNA template ATCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCA CCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTAC TCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGAT 601-Forward primer 5’-ATCCTGGAGAATCCCGGTGCCG-3’ 601-Reverse primer 5’-ATCACAGGATGTATATATCTGACACGTG-3’ Lambda -Forward primer 5’-CGGCTTCTGACTCTCTTTCC-3' Lambda -Reverse primer 5’-TTCCTTCAAGCTTTGCCACA-3’ To amplify the 601 DNA sequence, we used the following template and primer pair.

    Article Title: RPA directly stimulates Mer3 helicase processivity to ensure normal crossover formation in meiosis
    Article Snippet: The dsDNA hairpin was obtained by PCR amplification with Phusion High-Fidelity DNA Polymerase (Thermo Scientific) using Lambda DNA (New England Biolabs) as template and oligonucleotides that include different BsaI restriction sites in each side of the PCR fragment (see Supplementary Tables and for oligonucleotides) followed by purification (QIAGEN) as described previously .

    Article Title: Detection of known gene fusions in cancer cell lines using whole-genome bisulfite sequencing data
    Article Snippet: Spike-in controls consisting of pUC19 (0.1%) and lambda DNA (0.1%) from the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) were added to the sheared DNA.

    Article Title: In‑Situ ssDNA Isolation from dsDNA Sources as a Streamlined Pathway to DNA Origami Assembly and Testing
    Article Snippet: Lambda DNA, pUC19, and phiX174 single-stranded and supercoiled DNA were purchased from New England Biolabs (N3011S, N3041S, N3021S, N3023S).

    Article Title: 3 RAD ‐Guided SNP Discovery for Species Identification and Conservation of the Medicinal Southern African Tree Genus Greyia Hook. & Harv.
    Article Snippet: The integrity and quantity of DNA extracted from the ascertainment panel plants was first evaluated on a 1% agarose gel, alongside a dilution series of lambda DNA (New England Biolabs, Massachusetts) ranging from 8 ng to 67 ng.

    Lambda DNA Preparation:

    Article Title: Detection of known gene fusions in cancer cell lines using whole-genome bisulfite sequencing data.
    Article Snippet: Spike-in controls AR TIC LE IN PR ES S consisting of pUC19 (0.1%) and lambda DNA (0.1%) from the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) were added to the sheared DNA.

    Article Title: Recognition and remodelling of nucleosomes and hexasomes by the human INO80 complex
    Article Snippet: Reactions were stopped by adding Lambda DNA (0.2 mg/ml; NEB).

    Article Title: Recognition and remodelling of nucleosomes and hexasomes by the human INO80 complex.
    Article Snippet: Reactions were stopped by adding Lambda DNA (0.2 mg/ml; NEB).

    Article Title: High-Yield Production of Modified DNA Enables Structural Analysis of PARP2 Recognition of Nucleosomal Single-Strand Breaks.
    Article Snippet: To amplify 601 and Lambda DNA (NEB, N3011S), the following template and primer sequences were used: 601 DNA template ATCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCA CCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTAC TCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGAT 601-Forward primer 5’-ATCCTGGAGAATCCCGGTGCCG-3’ 601-Reverse primer 5’-ATCACAGGATGTATATATCTGACACGTG-3’ Lambda -Forward primer 5’-CGGCTTCTGACTCTCTTTCC-3' Lambda -Reverse primer 5’-TTCCTTCAAGCTTTGCCACA-3’ To amplify the 601 DNA sequence, we used the following template and primer pair.

    Article Title: RPA directly stimulates Mer3 helicase processivity to ensure normal crossover formation in meiosis
    Article Snippet: The dsDNA hairpin was obtained by PCR amplification with Phusion High-Fidelity DNA Polymerase (Thermo Scientific) using Lambda DNA (New England Biolabs) as template and oligonucleotides that include different BsaI restriction sites in each side of the PCR fragment (see Supplementary Tables and for oligonucleotides) followed by purification (QIAGEN) as described previously .

    Article Title: Detection of known gene fusions in cancer cell lines using whole-genome bisulfite sequencing data
    Article Snippet: Spike-in controls consisting of pUC19 (0.1%) and lambda DNA (0.1%) from the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) were added to the sheared DNA.

    Article Title: In‑Situ ssDNA Isolation from dsDNA Sources as a Streamlined Pathway to DNA Origami Assembly and Testing
    Article Snippet: Lambda DNA, pUC19, and phiX174 single-stranded and supercoiled DNA were purchased from New England Biolabs (N3011S, N3041S, N3021S, N3023S).

    Article Title: 3 RAD ‐Guided SNP Discovery for Species Identification and Conservation of the Medicinal Southern African Tree Genus Greyia Hook. & Harv.
    Article Snippet: The integrity and quantity of DNA extracted from the ascertainment panel plants was first evaluated on a 1% agarose gel, alongside a dilution series of lambda DNA (New England Biolabs, Massachusetts) ranging from 8 ng to 67 ng.

    Polymerase Chain Reaction:

    Article Title: Detection of known gene fusions in cancer cell lines using whole-genome bisulfite sequencing data.
    Article Snippet: Spike-in controls AR TIC LE IN PR ES S consisting of pUC19 (0.1%) and lambda DNA (0.1%) from the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) were added to the sheared DNA.

    Article Title: Recognition and remodelling of nucleosomes and hexasomes by the human INO80 complex
    Article Snippet: Reactions were stopped by adding Lambda DNA (0.2 mg/ml; NEB).

    Article Title: Recognition and remodelling of nucleosomes and hexasomes by the human INO80 complex.
    Article Snippet: Reactions were stopped by adding Lambda DNA (0.2 mg/ml; NEB).

    Article Title: High-Yield Production of Modified DNA Enables Structural Analysis of PARP2 Recognition of Nucleosomal Single-Strand Breaks.
    Article Snippet: To amplify 601 and Lambda DNA (NEB, N3011S), the following template and primer sequences were used: 601 DNA template ATCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCA CCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTAC TCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGAT 601-Forward primer 5’-ATCCTGGAGAATCCCGGTGCCG-3’ 601-Reverse primer 5’-ATCACAGGATGTATATATCTGACACGTG-3’ Lambda -Forward primer 5’-CGGCTTCTGACTCTCTTTCC-3' Lambda -Reverse primer 5’-TTCCTTCAAGCTTTGCCACA-3’ To amplify the 601 DNA sequence, we used the following template and primer pair.

    Article Title: RPA directly stimulates Mer3 helicase processivity to ensure normal crossover formation in meiosis
    Article Snippet: The dsDNA hairpin was obtained by PCR amplification with Phusion High-Fidelity DNA Polymerase (Thermo Scientific) using Lambda DNA (New England Biolabs) as template and oligonucleotides that include different BsaI restriction sites in each side of the PCR fragment (see Supplementary Tables and for oligonucleotides) followed by purification (QIAGEN) as described previously .

    Article Title: Detection of known gene fusions in cancer cell lines using whole-genome bisulfite sequencing data
    Article Snippet: Spike-in controls consisting of pUC19 (0.1%) and lambda DNA (0.1%) from the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) were added to the sheared DNA.

    Article Title: In‑Situ ssDNA Isolation from dsDNA Sources as a Streamlined Pathway to DNA Origami Assembly and Testing
    Article Snippet: Lambda DNA, pUC19, and phiX174 single-stranded and supercoiled DNA were purchased from New England Biolabs (N3011S, N3041S, N3021S, N3023S).

    Article Title: 3 RAD ‐Guided SNP Discovery for Species Identification and Conservation of the Medicinal Southern African Tree Genus Greyia Hook. & Harv.
    Article Snippet: The integrity and quantity of DNA extracted from the ascertainment panel plants was first evaluated on a 1% agarose gel, alongside a dilution series of lambda DNA (New England Biolabs, Massachusetts) ranging from 8 ng to 67 ng.

    Amplification:

    Article Title: Detection of known gene fusions in cancer cell lines using whole-genome bisulfite sequencing data.
    Article Snippet: Spike-in controls AR TIC LE IN PR ES S consisting of pUC19 (0.1%) and lambda DNA (0.1%) from the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) were added to the sheared DNA.

    Article Title: Recognition and remodelling of nucleosomes and hexasomes by the human INO80 complex
    Article Snippet: Reactions were stopped by adding Lambda DNA (0.2 mg/ml; NEB).

    Article Title: Recognition and remodelling of nucleosomes and hexasomes by the human INO80 complex.
    Article Snippet: Reactions were stopped by adding Lambda DNA (0.2 mg/ml; NEB).

    Article Title: High-Yield Production of Modified DNA Enables Structural Analysis of PARP2 Recognition of Nucleosomal Single-Strand Breaks.
    Article Snippet: To amplify 601 and Lambda DNA (NEB, N3011S), the following template and primer sequences were used: 601 DNA template ATCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCA CCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTAC TCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGAT 601-Forward primer 5’-ATCCTGGAGAATCCCGGTGCCG-3’ 601-Reverse primer 5’-ATCACAGGATGTATATATCTGACACGTG-3’ Lambda -Forward primer 5’-CGGCTTCTGACTCTCTTTCC-3' Lambda -Reverse primer 5’-TTCCTTCAAGCTTTGCCACA-3’ To amplify the 601 DNA sequence, we used the following template and primer pair.

    Article Title: RPA directly stimulates Mer3 helicase processivity to ensure normal crossover formation in meiosis
    Article Snippet: The dsDNA hairpin was obtained by PCR amplification with Phusion High-Fidelity DNA Polymerase (Thermo Scientific) using Lambda DNA (New England Biolabs) as template and oligonucleotides that include different BsaI restriction sites in each side of the PCR fragment (see Supplementary Tables and for oligonucleotides) followed by purification (QIAGEN) as described previously .

    Article Title: Detection of known gene fusions in cancer cell lines using whole-genome bisulfite sequencing data
    Article Snippet: Spike-in controls consisting of pUC19 (0.1%) and lambda DNA (0.1%) from the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) were added to the sheared DNA.

    Article Title: In‑Situ ssDNA Isolation from dsDNA Sources as a Streamlined Pathway to DNA Origami Assembly and Testing
    Article Snippet: Lambda DNA, pUC19, and phiX174 single-stranded and supercoiled DNA were purchased from New England Biolabs (N3011S, N3041S, N3021S, N3023S).

    Article Title: 3 RAD ‐Guided SNP Discovery for Species Identification and Conservation of the Medicinal Southern African Tree Genus Greyia Hook. & Harv.
    Article Snippet: The integrity and quantity of DNA extracted from the ascertainment panel plants was first evaluated on a 1% agarose gel, alongside a dilution series of lambda DNA (New England Biolabs, Massachusetts) ranging from 8 ng to 67 ng.

    Purification:

    Article Title: Detection of known gene fusions in cancer cell lines using whole-genome bisulfite sequencing data.
    Article Snippet: Spike-in controls AR TIC LE IN PR ES S consisting of pUC19 (0.1%) and lambda DNA (0.1%) from the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) were added to the sheared DNA.

    Article Title: Recognition and remodelling of nucleosomes and hexasomes by the human INO80 complex
    Article Snippet: Reactions were stopped by adding Lambda DNA (0.2 mg/ml; NEB).

    Article Title: Recognition and remodelling of nucleosomes and hexasomes by the human INO80 complex.
    Article Snippet: Reactions were stopped by adding Lambda DNA (0.2 mg/ml; NEB).

    Article Title: High-Yield Production of Modified DNA Enables Structural Analysis of PARP2 Recognition of Nucleosomal Single-Strand Breaks.
    Article Snippet: To amplify 601 and Lambda DNA (NEB, N3011S), the following template and primer sequences were used: 601 DNA template ATCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCA CCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTAC TCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGAT 601-Forward primer 5’-ATCCTGGAGAATCCCGGTGCCG-3’ 601-Reverse primer 5’-ATCACAGGATGTATATATCTGACACGTG-3’ Lambda -Forward primer 5’-CGGCTTCTGACTCTCTTTCC-3' Lambda -Reverse primer 5’-TTCCTTCAAGCTTTGCCACA-3’ To amplify the 601 DNA sequence, we used the following template and primer pair.

    Article Title: RPA directly stimulates Mer3 helicase processivity to ensure normal crossover formation in meiosis
    Article Snippet: The dsDNA hairpin was obtained by PCR amplification with Phusion High-Fidelity DNA Polymerase (Thermo Scientific) using Lambda DNA (New England Biolabs) as template and oligonucleotides that include different BsaI restriction sites in each side of the PCR fragment (see Supplementary Tables and for oligonucleotides) followed by purification (QIAGEN) as described previously .

    Article Title: Detection of known gene fusions in cancer cell lines using whole-genome bisulfite sequencing data
    Article Snippet: Spike-in controls consisting of pUC19 (0.1%) and lambda DNA (0.1%) from the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) were added to the sheared DNA.

    Article Title: In‑Situ ssDNA Isolation from dsDNA Sources as a Streamlined Pathway to DNA Origami Assembly and Testing
    Article Snippet: Lambda DNA, pUC19, and phiX174 single-stranded and supercoiled DNA were purchased from New England Biolabs (N3011S, N3041S, N3021S, N3023S).

    Article Title: 3 RAD ‐Guided SNP Discovery for Species Identification and Conservation of the Medicinal Southern African Tree Genus Greyia Hook. & Harv.
    Article Snippet: The integrity and quantity of DNA extracted from the ascertainment panel plants was first evaluated on a 1% agarose gel, alongside a dilution series of lambda DNA (New England Biolabs, Massachusetts) ranging from 8 ng to 67 ng.

    Sequencing:

    Article Title: Detection of known gene fusions in cancer cell lines using whole-genome bisulfite sequencing data.
    Article Snippet: Spike-in controls AR TIC LE IN PR ES S consisting of pUC19 (0.1%) and lambda DNA (0.1%) from the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) were added to the sheared DNA.

    Article Title: Recognition and remodelling of nucleosomes and hexasomes by the human INO80 complex
    Article Snippet: Reactions were stopped by adding Lambda DNA (0.2 mg/ml; NEB).

    Article Title: Recognition and remodelling of nucleosomes and hexasomes by the human INO80 complex.
    Article Snippet: Reactions were stopped by adding Lambda DNA (0.2 mg/ml; NEB).

    Article Title: High-Yield Production of Modified DNA Enables Structural Analysis of PARP2 Recognition of Nucleosomal Single-Strand Breaks.
    Article Snippet: To amplify 601 and Lambda DNA (NEB, N3011S), the following template and primer sequences were used: 601 DNA template ATCCTGGAGAATCCCGGTGCCGAGGCCGCTCAATTGGTCGTAGACAGCTCTAGCA CCGCTTAAACGCACGTACGCGCTGTCCCCCGCGTTTTAACCGCCAAGGGGATTAC TCCCTAGTCTCCAGGCACGTGTCAGATATATACATCCTGTGAT 601-Forward primer 5’-ATCCTGGAGAATCCCGGTGCCG-3’ 601-Reverse primer 5’-ATCACAGGATGTATATATCTGACACGTG-3’ Lambda -Forward primer 5’-CGGCTTCTGACTCTCTTTCC-3' Lambda -Reverse primer 5’-TTCCTTCAAGCTTTGCCACA-3’ To amplify the 601 DNA sequence, we used the following template and primer pair.

    Article Title: RPA directly stimulates Mer3 helicase processivity to ensure normal crossover formation in meiosis
    Article Snippet: The dsDNA hairpin was obtained by PCR amplification with Phusion High-Fidelity DNA Polymerase (Thermo Scientific) using Lambda DNA (New England Biolabs) as template and oligonucleotides that include different BsaI restriction sites in each side of the PCR fragment (see Supplementary Tables and for oligonucleotides) followed by purification (QIAGEN) as described previously .

    Article Title: Detection of known gene fusions in cancer cell lines using whole-genome bisulfite sequencing data
    Article Snippet: Spike-in controls consisting of pUC19 (0.1%) and lambda DNA (0.1%) from the NEBNext Enzymatic Methyl-seq Kit (New England Biolabs) were added to the sheared DNA.

    Article Title: In‑Situ ssDNA Isolation from dsDNA Sources as a Streamlined Pathway to DNA Origami Assembly and Testing
    Article Snippet: Lambda DNA, pUC19, and phiX174 single-stranded and supercoiled DNA were purchased from New England Biolabs (N3011S, N3041S, N3021S, N3023S).

    Article Title: 3 RAD ‐Guided SNP Discovery for Species Identification and Conservation of the Medicinal Southern African Tree Genus Greyia Hook. & Harv.
    Article Snippet: The integrity and quantity of DNA extracted from the ascertainment panel plants was first evaluated on a 1% agarose gel, alongside a dilution series of lambda DNA (New England Biolabs, Massachusetts) ranging from 8 ng to 67 ng.



    Similar Products

    99
    New England Biolabs hindiii digested lambda phage dna
    Hindiii Digested Lambda Phage Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lambda+dna/HindIII/pmc13179615-117-16-20
    Average 99 stars, based on 1 article reviews
    hindiii digested lambda phage dna - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    94
    Jena Bioscience λ dna
    λ Dna, supplied by Jena Bioscience, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lambda+dna/Lambda+DNA/10__1021_slash_jacsau__6c00003-179-36-37
    Average 94 stars, based on 1 article reviews
    λ dna - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    96
    New England Biolabs lambda dna neb cat
    Lambda Dna Neb Cat, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lambda+dna/Lambda+DNA/pm42102803-137-13-15
    Average 96 stars, based on 1 article reviews
    lambda dna neb cat - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    97
    New England Biolabs spike
    Spike, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lambda+dna/Lambda+DNA/pm42102803-147-7-9
    Average 97 stars, based on 1 article reviews
    spike - by Bioz Stars, 2026-10
    97/100 stars
      Buy from Supplier

    96
    New England Biolabs lambda dna
    Lambda Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lambda+dna/Lambda+DNA/pmc13139959-242-25-27
    Average 96 stars, based on 1 article reviews
    lambda dna - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    97
    New England Biolabs biotin labeled λ dna
    Biotin Labeled λ Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lambda+dna/Lambda+DNA/pmc13176981-40-11-16
    Average 97 stars, based on 1 article reviews
    biotin labeled λ dna - by Bioz Stars, 2026-10
    97/100 stars
      Buy from Supplier

    96
    New England Biolabs lambda genomic dna
    Lambda Genomic Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lambda+dna/Lambda+DNA/us12601003-638-2-6
    Average 96 stars, based on 1 article reviews
    lambda genomic dna - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    New England Biolabs unmethylated lambda dna
    Unmethylated Lambda Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lambda+dna/Lambda+DNA/us12595506-551-113-130
    Average 96 stars, based on 1 article reviews
    unmethylated lambda dna - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    96
    New England Biolabs lambda dna pfge marker
    Dendrogram generated from <t>PFGE</t> analysis of A. pleuropneumoniae strains digested with the ApaI restriction enzyme, with corresponding epidemiological information and antimicrobial resistance profiles. Colored boxes adjacent to each strain identify the PFGE profiles.
    Lambda Dna Pfge Marker, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lambda+dna/Lambda+DNA/pmc13119391-97-6-10
    Average 96 stars, based on 1 article reviews
    lambda dna pfge marker - by Bioz Stars, 2026-10
    96/100 stars
      Buy from Supplier

    97
    New England Biolabs λ dna
    Dendrogram generated from <t>PFGE</t> analysis of A. pleuropneumoniae strains digested with the ApaI restriction enzyme, with corresponding epidemiological information and antimicrobial resistance profiles. Colored boxes adjacent to each strain identify the PFGE profiles.
    λ Dna, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lambda+dna/Lambda+DNA/bio_rxiv__64898__2026__04__01__715814-264-18-19
    Average 97 stars, based on 1 article reviews
    λ dna - by Bioz Stars, 2026-10
    97/100 stars
      Buy from Supplier

    Image Search Results


    Dendrogram generated from PFGE analysis of A. pleuropneumoniae strains digested with the ApaI restriction enzyme, with corresponding epidemiological information and antimicrobial resistance profiles. Colored boxes adjacent to each strain identify the PFGE profiles.

    Journal: Microorganisms

    Article Title: Serotypes, MIC-Based Antimicrobial Susceptibility, and Genotypic Diversity of Actinobacillus pleuropneumoniae Isolates from Diseased Pigs in Brazil

    doi: 10.3390/microorganisms14040828

    Figure Lengend Snippet: Dendrogram generated from PFGE analysis of A. pleuropneumoniae strains digested with the ApaI restriction enzyme, with corresponding epidemiological information and antimicrobial resistance profiles. Colored boxes adjacent to each strain identify the PFGE profiles.

    Article Snippet: Band sizes were estimated using a lambda DNA PFGE marker (New England BioLabs, Ipswich, MA, USA).

    Techniques: Generated